View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14629_low_18 (Length: 350)
Name: NF14629_low_18
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14629_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 1e-69; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 206 - 343
Target Start/End: Original strand, 10102969 - 10103106
Alignment:
| Q |
206 |
ttaacgtctcataatgtattttagggtaatgaagttgtactttatcatccagcagaagaatttttaccaactatccaagaggtaatattattcattaatt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10102969 |
ttaacgtctcataatgtattttagggtaatgaagttgtactttatcatccagcagaagaatttttaccaacaatccaagaggtaatattattcattaatt |
10103068 |
T |
|
| Q |
306 |
tgttcttaaaatgaacaaacttctttatgtaccctttg |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10103069 |
tgttcttaaaatgaacaaacttctttatgtaccctttg |
10103106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 10102463 - 10102543
Alignment:
| Q |
1 |
acatatcaacttcactggggtcttccaagtatcatgataagaatcatcaaacaaagggtgttgatgaaaaggtttacaagc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10102463 |
acatatcaacttcactggggtcttccaagtatcatgataagaatcatcaaacaaagggtgttgatgaaaaggtttacaagc |
10102543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 137 - 202
Target Start/End: Original strand, 10102598 - 10102663
Alignment:
| Q |
137 |
atgaaattcacatttctcttattatcagaacaatcttgtttgagacatacataacaataaggataa |
202 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10102598 |
atgaaattcacatttctcttattatcataacaatcttgtttgagacatacataacaataagaataa |
10102663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University