View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14629_low_23 (Length: 306)
Name: NF14629_low_23
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14629_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 106 - 297
Target Start/End: Original strand, 37859842 - 37860032
Alignment:
| Q |
106 |
tgaggatgttatgaggtgagagcaaattttggagagtgttaagcaaaaggcatggtttggttattggnnnnnnngttgttgtttgaaatgaaattgaaga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37859842 |
tgaggatgttatgaggtgagagcaaattttggagagtgttaaaccaaagacatggtttggttattggtttttt-gttgttgtttgaaatgaaattgaaga |
37859940 |
T |
 |
| Q |
206 |
ttaggtttgtaaggataagggagaaaattagagggttgagaagagaggaatggagatgaatgaggagtgaaatgggtgggtctaatatatat |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37859941 |
ttaggtttgtaaggataagggagaaaattagagggttgagaagagaggaatggagatgaatgaggagtgaaatgggtgggtctaatatatat |
37860032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University