View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14629_low_29 (Length: 270)
Name: NF14629_low_29
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14629_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 265
Target Start/End: Complemental strand, 6022387 - 6022142
Alignment:
| Q |
20 |
taccgatattgatgttgttgatgaacaggtatgtatcatttgatgaatgaaaatgaactttattttctcttgaatttttctgcttatactttagtttttg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6022387 |
taccgatattgatgttgttgatgaacaggtaggtatcatttgatgaatgaaaatgaactttattttctcttgaatttttctgcttatattttagtttttg |
6022288 |
T |
 |
| Q |
120 |
attctgtatgtgattaggaacttagggaagcttcgttgcatattcaacccaaacatgaaaaagaaatttcggttttaattgattcgtatgctgctgtgta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
6022287 |
attctgtatgtgattaggaacttagggaagcttcgttgcatattcaaccgaaacatgaaaaagaaattgcggttttaattgattcgtatgctgctgttta |
6022188 |
T |
 |
| Q |
220 |
tcctgaatggcttctctccctgaggtattactctcttttcattctt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6022187 |
tcctgaatggcttctctccctgaggtattactctcttttcattctt |
6022142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University