View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14629_low_35 (Length: 238)
Name: NF14629_low_35
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14629_low_35 |
 | |
|
| [»] scaffold0169 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 42 - 214
Target Start/End: Original strand, 8343443 - 8343612
Alignment:
| Q |
42 |
attttcaccttaaaatatagatttttcaatcacttgcttatagtgccaaaatctcagtatatgtagccaagctaagcaatttcaactttgttgattagat |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8343443 |
attttcaccttaaaatatagatttttcaatcacttgcttatagtgccaaaatctcagtatatgtagccaagctaagcaatttcaactttgt---ttagat |
8343539 |
T |
|
| Q |
142 |
aacttaggtatgtggtgtagcaaatattcagatatccatatggataggaatatgataaagcttactcatatat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8343540 |
aacttaggtatgtggtgtagcaaatattcagatatccatatggataggaatatgataaagcttactcagatat |
8343612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 8342992 - 8343041
Alignment:
| Q |
1 |
cttttgtgtagaacacgaaaagtcatctaagtatttgtctaattttcacc |
50 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8342992 |
cttttgtgtagaacaagaaaagtcatctaagtatttgtctaattttcacc |
8343041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0169 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0169
Description:
Target: scaffold0169; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 36 - 138
Target Start/End: Original strand, 25661 - 25758
Alignment:
| Q |
36 |
tgtctaattttcaccttaaaatatagatttttcaatcacttgcttatagtgccaaaatctcagtatatgtagccaagctaagcaatttcaactttgttga |
135 |
Q |
| |
|
||||| ||| |||||||||| |||| | |||||||| |||||||||||||||| | ||||||||||||| ||||||||| || ||||||| ||||| |
|
|
| T |
25661 |
tgtcttattctcaccttaaagtataaacttttcaataacttgcttatagtgcccacatctcagtatatg-----aagctaagccatatcaacttcgttga |
25755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University