View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14629_low_36 (Length: 238)
Name: NF14629_low_36
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14629_low_36 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 39918751 - 39918971
Alignment:
| Q |
18 |
cttcttagccgttccaagagacggaaaatatggggccggatcatataattggtccggctccgaaagctttttaatggacccaccgagttcgtgggcttta |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918751 |
cttcttagccattccaagagacggaaaatatggggccggatcagataactggtccggctccgaaagctttttaatggacccaccgagttcgtgggcttta |
39918850 |
T |
 |
| Q |
118 |
gtaagtgtttggaactgcaaagacgtgtttacccttgaagtaaaaggcgcatcgcgcctgagacgtgtgttagcaaaaacaactcgactgatagacaagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918851 |
gtaagtgtttggaactgcaaagacgtgtttacccttgaagtaaaaggcgcatcgcgcgtgagacgtgtgttagcaaaaacaactcgactgatagacaagg |
39918950 |
T |
 |
| Q |
218 |
ctttaccttggttaaaattac |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39918951 |
ctttaccttggttaaaattac |
39918971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University