View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14629_low_40 (Length: 236)
Name: NF14629_low_40
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14629_low_40 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 35373608 - 35373390
Alignment:
| Q |
18 |
gttggaatcactaagctaactctcatggcaatcaaaaatctccactcgacgaacttgtgcacaacaaaattcacaaacaacaaattgacactacaaaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35373608 |
gttggaatcactaagctaactctcatggcaatcaaaaatctccactcgacgaacttgtgcacaacaaaattcacaaacaacaaattgacactacaaaatt |
35373509 |
T |
|
| Q |
118 |
tcaaagagactagaaatgaaagaatataaaatttcaaagaga---ctaaaattgaacacaaactaaaattgctagttattgccttatatagaaatgtcga |
214 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || | | | |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35373508 |
tcaaagagactaaaaatgaaagaatataaaatttcagggacattttttattttgaacacaaactaaaattgctag---ttgccttatatagaaatgtcga |
35373412 |
T |
|
| Q |
215 |
aaagttattgacaaaaattaat |
236 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35373411 |
aaagttattgacaaaaattaat |
35373390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University