View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14629_low_42 (Length: 227)
Name: NF14629_low_42
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14629_low_42 |
 | |
|
| [»] scaffold0565 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0565 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 127 - 220
Target Start/End: Complemental strand, 4648 - 4558
Alignment:
| Q |
127 |
gcttctaattaataatgtcacatatgattatctttttacttcatttggatagccaccacatccttaattactttccataatttatcactatttt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4648 |
gcttctaattaataatgtcacatatgattatttttttacttcatttggatag---ccacatccttaattattttccataatttatcactatttt |
4558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University