View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1462_low_5 (Length: 295)
Name: NF1462_low_5
Description: NF1462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1462_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 14 - 283
Target Start/End: Complemental strand, 18128029 - 18127760
Alignment:
| Q |
14 |
agagaaaagtagattcccactgcacatgttatgtgctagacaatgtttaatttgtcttggcttgggtagggaccaaatacattttttatataagattttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18128029 |
agagaaaagtagattcccactgcacatgttatgtgctagacaatgtttaatttgtcttggcttgggtagggaccaaatacattttttatataagattttc |
18127930 |
T |
|
| Q |
114 |
caaaccttgatgattacctcaaacattgcatgcatatgatatctgtatggaacactgttcccccaccattctctctctctacaaatatattggttaatct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18127929 |
caaaccttgatgattacctcaaacattgcatgcatatgatatctgtatggaacactgttcccccaccattctctctctctacaaatatattggttaatct |
18127830 |
T |
|
| Q |
214 |
attgcattatgctttatcttttagcggctgataaggtataactaaattatgtcacacccaagttgatatt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18127829 |
attgcattatgctttatcttttagcggctgataaggtttaactaaattatgtcacacccaagttgatatt |
18127760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University