View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14630_high_12 (Length: 245)
Name: NF14630_high_12
Description: NF14630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14630_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 105 - 240
Target Start/End: Complemental strand, 34249361 - 34249223
Alignment:
| Q |
105 |
aatattaatatcaataacatctaaagtcttttagataatataataaggtctcttttgaattaacaagtcttaactttaaattcagttttgaaaatgaaaa |
204 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| | ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
34249361 |
aatattaatattaataacatctaaagtctttttgatgagataataaggtctcttttgaattaacaattcttaactttaaattcaattttgaaaatgaaaa |
34249262 |
T |
 |
| Q |
205 |
agtgttaaatctgttaaaca---tgaatactttcatctc |
240 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
34249261 |
agtgttaaatcttttaaacatgttgaatactttcatctc |
34249223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 34249464 - 34249430
Alignment:
| Q |
1 |
cgttttaagaattggaaatatgttcaaattagtca |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34249464 |
cgttttaagaattggaaatatgttcaaattagtca |
34249430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University