View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14630_low_9 (Length: 328)
Name: NF14630_low_9
Description: NF14630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14630_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 179 - 312
Target Start/End: Complemental strand, 52518952 - 52518819
Alignment:
| Q |
179 |
ctaagggctgaatatattaagttttgaatggcatcaatatcttgttttagtaagagtccattgcccatgaaagagacagctttgagccatggtgaatatc |
278 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518952 |
ctaagggctgaatatattaagttgtgaatggcatcaacatcttgttttagtaagagtccattacccatgaaagagacagctttgagccatggtgaatatc |
52518853 |
T |
 |
| Q |
279 |
ctccacctatggcaacttatgaggaggttgtaga |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52518852 |
ctccacctatggcaacttatgaggaggttgtaga |
52518819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University