View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14631_low_10 (Length: 248)
Name: NF14631_low_10
Description: NF14631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14631_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 38025625 - 38025398
Alignment:
| Q |
1 |
ttggaagaaaatttggaatgtaaattcacatcacaaaatttatcacacaaattatggtatagtctagtatacttttattgataacaaatttacactactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38025625 |
ttggaagaaaatttggaatgtaaattcacatcacaaaatttatcacacaaattatggtatagtctagtatacttttattgataacaaatttacactactc |
38025526 |
T |
 |
| Q |
101 |
catctattcggtcctaatacacaatcatctacttcaatttcaatagttctgttttaacttttaaacactcagctcaagaatatttatcacgaacaaatta |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38025525 |
catctattcggtcttaatacacaatcatctactt------caatagttctgttttaacttttaaacactcagctcaaaaatatttatcacgaacaaatta |
38025432 |
T |
 |
| Q |
201 |
atcaagatgtggtaagtttttgttgatagaaaat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
38025431 |
atcaagatgtggtaagtttttgttgatagcaaat |
38025398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 14 - 103
Target Start/End: Complemental strand, 38032270 - 38032176
Alignment:
| Q |
14 |
tggaatgtaaattcacatcacaaaatttatcacacaaattatggtatagtcta-----gtatacttttattgataacaaatttacactactccat |
103 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38032270 |
tggaaagtaaattcacatcacaaaatttatcacacaaattatggtatagtctagtaatgtatacttttattgatagcaaatttacactactccat |
38032176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University