View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14631_low_12 (Length: 247)

Name: NF14631_low_12

Description: NF14631

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF14631_low_12

[»] chr7 (2 HSPs)

Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)

Name: chr7

Description:

Target: chr7; HSP #1

Raw Score: 138; E-Value: 3e-72

Query Start/End: Original strand, 75 - 241

Target Start/End: Original strand, 36733144 - 36733316

Alignment:

Q	75	tgaaaaaatttcaactattatctttttatcaccgattgcaatagc------acacgtttgtacctaactatagattacgtccacgtgccattacatgtgt	168	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	36733144	tgaaaaaatttcaactattatctttctatcaccgattgcaatagcagtagcacacgtttgtatctaactatagattacgtccacgtgccattacatgtgt	36733243	T

Q	169	acaatatacattgaacccgacaaacagagctttcttcgcaaacacagacattcggtgacattttatattcttc	241	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	36733244	acaatatacattgaacccgacaaacagagcttttttcgcaaacacagacattcggtgacattttatattcttc	36733316	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2

Raw Score: 42; E-Value: 0.000000000000006

Query Start/End: Original strand, 1 - 46

Target Start/End: Original strand, 36733031 - 36733076

Alignment:

Q	1	gtctttcctttaatgatatttttgaatttacatgcttaaaaatatt	46	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	36733031	gtctttcttttaatgatatttttgaatttacatgcttaaaaatatt	36733076	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]