View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14631_low_15 (Length: 224)
Name: NF14631_low_15
Description: NF14631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14631_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 40673057 - 40672864
Alignment:
| Q |
13 |
gagatgaatatggcgatgtgactctcaagacatcaactcttcaacctttcaacggcagcatgattgagctgaagctgaaagtagactcgtatgagccact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40673057 |
gagatgaatatggcgatgtgactctcaagacatcaactattcaacctttcaacggcagcatgattgagctgaagctgaaagtagactcgtatgagccact |
40672958 |
T |
 |
| Q |
113 |
tcacttggccgagagcattgttcgaaggcgccgtaaacatggaagggttgcattcgggctcaaagtgttcacttccatcgggttcaagagttat |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40672957 |
tcacttggccgagagcattgttcggaggcgccgtgaacatggaagggttgcattcgggctcaaagtgttcacttccatcgggttcaagagttat |
40672864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 33 - 191
Target Start/End: Complemental strand, 40683354 - 40683199
Alignment:
| Q |
33 |
actctcaagacatcaactcttcaacctttcaacggcagcatgattgagctgaagctgaaagtagactcgtatgagccacttcacttggccgagagcattg |
132 |
Q |
| |
|
||||| || ||||||||| |||||||||||||||| |||||||||||| |||||||||| |||||||||| |||||| |||| || | | | |||| |
|
|
| T |
40683354 |
actctaaatacatcaactattcaacctttcaacggtagcatgattgagatgaagctgaaggtagactcgtgtgagcc---tcacgtgactaacaacattt |
40683258 |
T |
 |
| Q |
133 |
ttcgaaggcgccgtaaacatggaagggttgcattcgggctcaaagtgttcacttccatc |
191 |
Q |
| |
|
||| || ||||| ||||||||||||||| |||||| |||||| |||||||||||||| |
|
|
| T |
40683257 |
atcgtagccgccgagaacatggaagggttgaattcggtctcaaattgttcacttccatc |
40683199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University