View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14631_low_8 (Length: 314)
Name: NF14631_low_8
Description: NF14631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14631_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 19 - 311
Target Start/End: Original strand, 16012775 - 16013066
Alignment:
| Q |
19 |
taagcgggcaggcgcttgagaatagcgtagcggagtgaatggagctgaaactgcaacgagcgtagtgcagctagattgccttccgcttaagtttggccca |
118 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16012775 |
taagcgagcaggcaattgagaatagcgtagcgaagtgaatggagctgaaactgcaacgagcgtagtgcagctagagtgccttccgcttaagtttggccca |
16012874 |
T |
 |
| Q |
119 |
tacatatgttgggttacgattaggagggttggggtatagtgggcgaagcccctcgcattggaatttaagggtaaacttgaccgtagtatttaaacataac |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16012875 |
tacatatgttgggttaagattaggagggttggggtatagtgggcgaagtccctcgcattgcaatttaagggtaaacttgaccgtagtatttaaacataac |
16012974 |
T |
 |
| Q |
219 |
ttgtaatctgcaactgtaagagtttcatagtagaaactacagtagccactctattgtcggagacgtagggcacacttgctcgaactctgtgat |
311 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
16012975 |
ttgtaatctgcaactgcaagaatttcatagtagaaactacagtagccactctattgtcggagtcgta-ggcacacttgctcgaactctgtgat |
16013066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 189 - 228
Target Start/End: Complemental strand, 13855090 - 13855051
Alignment:
| Q |
189 |
gtaaacttgaccgtagtatttaaacataacttgtaatctg |
228 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
13855090 |
gtaaactagaccgtagtatttaaacataagttgtaatctg |
13855051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University