View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14632_low_6 (Length: 264)
Name: NF14632_low_6
Description: NF14632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14632_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 39 - 241
Target Start/End: Complemental strand, 6082861 - 6082659
Alignment:
| Q |
39 |
tggatcaattgacaaaattcgaaaatatcattgatgacttggtgaacattgaagggaacattgaggatgaagataaggatttactcttactatgcattat |
138 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6082861 |
tggatcaattgacaaaattcgagaatatcattgatgacttggtgaacattgaagggaacattgaggatgaagataaggatttactcttactatgcattat |
6082762 |
T |
|
| Q |
139 |
attttgaccactccatggataatatgctttatgaaaagtaaggtaaaatcatcttcaatgaagtctaatcagctcttagaaccatggagtcgaccaattt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
6082761 |
attttgaccactccatggataatatgctttatgaaaagtaaggtaaaatcatcttcaatgaagtctaatcggctcttagaaccatggagtcgaccaagtt |
6082662 |
T |
|
| Q |
239 |
taa |
241 |
Q |
| |
|
||| |
|
|
| T |
6082661 |
taa |
6082659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University