View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14632_low_9 (Length: 213)
Name: NF14632_low_9
Description: NF14632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14632_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 6082688 - 6082498
Alignment:
| Q |
1 |
tcttagaaccatggagtcgaccaaatttaaagagttgaaggtggcatgtggatgccttgaatgtatcaataggaagaggtgggagtagaggaaattgggg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6082688 |
tcttagaaccatggagtcgaccaagtttaaagagttgaaggtgg--tgtggatgccttgaatgtat----aggaagaggtgggagtagaggaaattgggg |
6082595 |
T |
|
| Q |
101 |
aaaattaaaatacaagggttgtgacaagtttatgtgtttcaagtttcttaagaccggtctctttaataaggattgtctcatgttggaaggaaataat |
197 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
6082594 |
aaaattaaaatacaagggtggtgaaaagtttatgtttttcaagtttcttaagaccggtctcttcaataaggattgtctcaagttggaaggaaataat |
6082498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University