View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14633_high_11 (Length: 250)
Name: NF14633_high_11
Description: NF14633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14633_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 169 - 246
Target Start/End: Original strand, 9888625 - 9888702
Alignment:
| Q |
169 |
tgtcagtaactccataataatgcctttttacttgcaatattttatctaaaaaagtactagtgattagtatcgaaaatt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9888625 |
tgtcagtaactccataataatgcctttttacttgcaatattttatctaaaaaagtactagtgattagtatcgaaaatt |
9888702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 83 - 171
Target Start/End: Original strand, 9888352 - 9888440
Alignment:
| Q |
83 |
ccctcgttggtttttcctgtgttctttgccacgttcaatattcttagtacagttggatttatttcgtagaaaattaattctcaacttgt |
171 |
Q |
| |
|
||||| |||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9888352 |
ccctcattggtttttcttgtgttctttaccacgttcaatattcttagtacacttggatttatttcgtagaaaattaattctcaacttgt |
9888440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University