View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14633_high_12 (Length: 239)
Name: NF14633_high_12
Description: NF14633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14633_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 291429 - 291655
Alignment:
| Q |
1 |
tatatcagtgttaaaggggatatataggaaagttggaaagaaccttcaaatcattggtgaacaaaggtttt------taagaggctgagataaagaattg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
291429 |
tatatcagtgttaaaggggatatataggaaagttggacagaaccttcaaatcattggtgaacaaaggtttttttttttaagaggctgagataaagaattg |
291528 |
T |
|
| Q |
95 |
gtttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctgcaatgtttatgagataattcat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
291529 |
gtttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctgcaatgtttatgagataattcat |
291628 |
T |
|
| Q |
195 |
ggtgtttgggagagacagagataggga |
221 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
291629 |
ggtgtttgggagagacagagatgggga |
291655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 80 - 209
Target Start/End: Complemental strand, 40261031 - 40260901
Alignment:
| Q |
80 |
tgagataaagaattgg-tttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctgcaatgt |
178 |
Q |
| |
|
||||||| | |||||| ||||||||||| ||||||||| || | |||||||||| |||||||| |||||||||||||||||| | | |||| || ||||| |
|
|
| T |
40261031 |
tgagatatataattggctttgattgtgaattctagcaaattcaatggtagttttgggattgaagcggttagtttattgaaactcgttaactatggaatgt |
40260932 |
T |
|
| Q |
179 |
ttatgagataattcatggtgtttgggagaga |
209 |
Q |
| |
|
|| ||||| ||||||||||||||||| |||| |
|
|
| T |
40260931 |
ttgtgagagaattcatggtgtttgggggaga |
40260901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University