View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14633_high_3 (Length: 349)
Name: NF14633_high_3
Description: NF14633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14633_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 33 - 191
Target Start/End: Complemental strand, 52629836 - 52629664
Alignment:
| Q |
33 |
atttattacgcatgaaagataataaactttgagcaactagattttgaccaccgtaagtgggtggt--------------agcaaattgagacaatagaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
52629836 |
atttattacgcatgaaagataataaactttgagcaactagattttgaccaccgtaagtgggtggttattatatgaaaggagcaaattgagccaatagaaa |
52629737 |
T |
 |
| Q |
119 |
atggagaagatgataggaaatgacaatcactttcacattatacacaaattttttatcacacataattctattc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52629736 |
atggagaagatgataggaaatgacaatcactttcacattatacacaaattttttattacacataattctattc |
52629664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 264 - 335
Target Start/End: Complemental strand, 52629591 - 52629520
Alignment:
| Q |
264 |
ttgtgatgttttgaagtcggtacaacatgcatggttctgtggcacatgatatgtcttttctatgaaatattt |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52629591 |
ttgtgatgttttgaagtcggtacaacatgcatggttctgtagcacatgatatgtcttttctatgaaatattt |
52629520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University