View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14633_high_7 (Length: 318)
Name: NF14633_high_7
Description: NF14633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14633_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 9 - 302
Target Start/End: Complemental strand, 53620874 - 53620581
Alignment:
| Q |
9 |
aagaagatactcttttcaatttttgacccaactcagaccatctggtggctttcttccagcgctgctcaaaattagttagtatatcatatgcagcaggccc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53620874 |
aagaagatactcttttcaatttttgacccaactcagaccatctggtggctttcttccagcgctgctcaaaattagttagtatatcatatgcagcaggccc |
53620775 |
T |
 |
| Q |
109 |
ttcgattttgcaatgtagatcatgccatggttgccttggacccttggttccggcctattattaaaatggaagataaaaagaaacctcacttggtaaggga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53620774 |
ttcgattttgcaatgtagatcatgccatggttgccttggacccttggttcctgcctattattaaaatggaagataaaaagaaacctcacttggtaagaga |
53620675 |
T |
 |
| Q |
209 |
gtacactggtgatctcaatctcaatatttaaaaaatcttagaataatttatgtttatgaaatatgtatcaattacatagaaagcttcacttaag |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53620674 |
gtacactggtgatctcaatctcaatatttaaaaaatcttagaataatttatgtttatgaaatatgtatcaattacatagaaagcttcacttaag |
53620581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 88 - 147
Target Start/End: Original strand, 36841068 - 36841127
Alignment:
| Q |
88 |
tatatcatatgcagcaggcccttcgattttgcaatgtagatcatgccatggttgccttgg |
147 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
36841068 |
tatatcatatgcagccggaccttcaattttgcaatgtaagtcatgccatggttgccttgg |
36841127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University