View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14634_low_5 (Length: 238)
Name: NF14634_low_5
Description: NF14634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14634_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 6 - 222
Target Start/End: Original strand, 53033471 - 53033694
Alignment:
| Q |
6 |
tttgctgtgactttatcctatttctgatctgcactgttattatgcatgcagtgagttacctactcctaccttattattattaccaccccctttccaaaca |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53033471 |
tttgcggtgactttatcctatttctgatctgcactgttattatgcatgcagt----tacctactcctaccttattattattaccaccccctttccaaaca |
53033566 |
T |
|
| Q |
106 |
aaaagtatt-----------tcaaatttaaatttcaacaggtggatatggcaccctcgaagaacttttggaaattattacctgggctcaactaggtatcc |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53033567 |
aaaagtattactaatctatttcaaatttaaatttcaacaggtggatatggcaccctcgaagaacttttggaaattattacctgggctcaactaggtatcc |
53033666 |
T |
|
| Q |
195 |
atgataaaccggtaagattgttgccctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
53033667 |
atgataaaccggtaagattgttgccctt |
53033694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 195
Target Start/End: Complemental strand, 25026543 - 25026480
Alignment:
| Q |
132 |
caggtggatatggcaccctcgaagaacttttggaaattattacctgggctcaactaggtatcca |
195 |
Q |
| |
|
||||||||||||| ||||| |||||| | ||||||||||||| ||||||||||| || ||||| |
|
|
| T |
25026543 |
caggtggatatggaacccttgaagaattgctggaaattattacttgggctcaacttgggatcca |
25026480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University