View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14634_low_6 (Length: 219)
Name: NF14634_low_6
Description: NF14634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14634_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 11 - 201
Target Start/End: Complemental strand, 16514129 - 16513939
Alignment:
| Q |
11 |
attattctcaatatcaaccttgaatgggctttccgatggaagtacaataagatcatttttcttgagtatttgacggcagattgggcacttaccacccatt |
110 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16514129 |
attattctcaatatcaaccttgaacgggctttccgatggaagtacaataagatcatttttcttgagtatttgacggcagattgggcacttaccacccatt |
16514030 |
T |
|
| Q |
111 |
gaggtgccccaacaattgaataggcattctctgcaaaactgatgtgcacatggtgtaaaaacaggatcatctggtgattccatgcatatag |
201 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16514029 |
gaggtaccccaacaattgaataggcattctctgcaaaactgatgtgcacatggtgtaaaaacaggatcatctggtgattccatgcatatag |
16513939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University