View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14635_low_15 (Length: 353)
Name: NF14635_low_15
Description: NF14635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14635_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 25 - 338
Target Start/End: Complemental strand, 46104618 - 46104305
Alignment:
| Q |
25 |
acattttctatttagaaaaagttgcttctatcccttctataataatatatcatcaaataaaaattacatgaatcacctcacaaatttttcttattgattc |
124 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46104618 |
acattttccatttagaaaaagttgcttctatcccttctataataatatatcatcaaataaaaattacatgaatcacctcacaaatttttcttattgattc |
46104519 |
T |
 |
| Q |
125 |
ctttgaactattttaacttccttgttgtgaattcgttcattcatcactcaaatcactagtgttacgtaccatacacaaaacatgaagaaactaactccct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46104518 |
ctttgaactattttaacttccttgttgtgaattcgttcattcatcactcaaatcactagtgttacgtaccatacacaaaacatgaagaaactaactccct |
46104419 |
T |
 |
| Q |
225 |
cctgtcttttcattcatctcaatttcattccctcaaataactttccacatgatcatgtgcttttacattgaacccacttggcaaatgcttcaagtgtttt |
324 |
Q |
| |
|
| ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46104418 |
cttgtcttttccttcatctcaatttcattccctcaaataacttttcacatgatcatgtgcttttacattgaacccacttggcaaatgcttcaagtgtttt |
46104319 |
T |
 |
| Q |
325 |
gatatcagctctgt |
338 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46104318 |
gatatcagctctgt |
46104305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University