View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14636_low_4 (Length: 421)

Name: NF14636_low_4
Description: NF14636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14636_low_4
NF14636_low_4
[»] chr2 (1 HSPs)
chr2 (365-401)||(44911522-44911558)


Alignment Details
Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 401
Target Start/End: Complemental strand, 44911558 - 44911522
Alignment:
365 aagactcttcaattcatgtccattttattttcacaca 401  Q
    |||||||||||||||||||||||||||||||||||||    
44911558 aagactcttcaattcatgtccattttattttcacaca 44911522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University