View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14637_high_5 (Length: 241)
Name: NF14637_high_5
Description: NF14637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14637_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 231
Target Start/End: Original strand, 26889411 - 26889627
Alignment:
| Q |
15 |
gctgggaagagaaagagttatggtagtgagaagaaggtgtataattcaaatggtgggggtggtgatagtagtgatgggactagtggaactgatatgagta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26889411 |
gctgggaagagaaagagttatggtagtgagaagaaggtgtataattcaaatggtgggggtggtgatagtagtgatgggactagtggaactgatatgagta |
26889510 |
T |
 |
| Q |
115 |
agcttgtgttttttgataggaggaatggatttgagttggaggatttgttgcgtgcatctgctgagatgcttgggaagggtaatttgggaactgtttatag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26889511 |
agcttgtgttttttgataggaggaatggatttgagttggaagatttgttgcgtgcatctgctgagatgcttgggaagggtagtttgggaactgtttatag |
26889610 |
T |
 |
| Q |
215 |
ggcagtgcttgatgatg |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26889611 |
ggcagtgcttgatgatg |
26889627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 120 - 231
Target Start/End: Complemental strand, 41847567 - 41847456
Alignment:
| Q |
120 |
gtgttttttgataggaggaatggatttgagttggaggatttgttgcgtgcatctgctgagatgcttgggaagggtaatttgggaactgtttatagggcag |
219 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| ||||||||| | || || ||||| ||||||||||||||||||| |||||||||||||||||| || | |
|
|
| T |
41847567 |
gtgttttttgatagaaggaatgagtttgagttagaggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctg |
41847468 |
T |
 |
| Q |
220 |
tgcttgatgatg |
231 |
Q |
| |
|
| |||||||||| |
|
|
| T |
41847467 |
ttcttgatgatg |
41847456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University