View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14637_low_7 (Length: 225)
Name: NF14637_low_7
Description: NF14637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14637_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 16 - 126
Target Start/End: Complemental strand, 7253378 - 7253262
Alignment:
| Q |
16 |
aatctcacatggaatatataactataatattgggcgatatgttattctaagtgttagt-------aatctaaagaagataagttttaaaacttttgaaag |
108 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7253378 |
aatctcacatggaatatataattataatattgggcgac-tgttattctcagtgttagttagtagtaatctaaagaagataagttttaaaacttttgaaag |
7253280 |
T |
 |
| Q |
109 |
agtcttaataacacattc |
126 |
Q |
| |
|
||| ||| ||||| |||| |
|
|
| T |
7253279 |
agtgttagtaacatattc |
7253262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 7253256 - 7253210
Alignment:
| Q |
165 |
acataatcacgtatgtcctttataacatacattttatactcgactgaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
7253256 |
acataatcacgtatgtcctttataacataca-tttatattcgactgaa |
7253210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University