View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14638_high_25 (Length: 229)
Name: NF14638_high_25
Description: NF14638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14638_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 17 - 214
Target Start/End: Complemental strand, 43958825 - 43958628
Alignment:
| Q |
17 |
caatgatgaaccctttcatctcatatcactgaacc--ttcatcaaaccattttatcttcatctgatacgtttttcatcaacaccaaaacaaactttcaac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43958825 |
caatgatgaaccctttcatctcatatcacttaaccctttcatcaaaccattttatcttcatctgataggtttttcatcaacaccaaaacaaactttcaac |
43958726 |
T |
 |
| Q |
115 |
acctacttacctagatcagtactggtttggctgaaaatgttagatttggaatacatattggtctcaggaccgtaatattttctttccttttgttttcatc |
214 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43958725 |
acctacttgcctagatcggtactggtttggctgaaaatggtag--ctggaatacatattggtctcaggaccgtaatattttctttccttttgttttcatc |
43958628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 214
Target Start/End: Complemental strand, 10919076 - 10918881
Alignment:
| Q |
19 |
atgatgaaccctttcatctcatatcactgaacc--ttcatcaaaccattttatcttcatctgatacgtttttcatcaacaccaaaacaaactttcaacac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10919076 |
atgatgaaccctttcatctcatatcactgaaccctttcgtcaaaccattttatcttcatctgatacgtttttcatcaacaccaaaacaaactttcaacac |
10918977 |
T |
 |
| Q |
117 |
ctacttacctagatcagtactggtttggctgaaaatgttagatttggaatacatattggtctcaggaccgtaatattttctttccttttgttttcatc |
214 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10918976 |
ctacttgtctagatcggtattggtttggctgaaaatggtag--ctggaatacatattggtctcaggaccgtaatattttctttccttttgttttcatc |
10918881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University