View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14638_low_24 (Length: 281)
Name: NF14638_low_24
Description: NF14638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14638_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 38727127 - 38726861
Alignment:
| Q |
1 |
actcgccacttgatacggcttcatatactaattgagggcatataaaatgcacatggcaatctatagccccagctgttacaatcaagccctctccagcaat |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38727127 |
actcaccacttgatacggcttcatatactaattgagggcatataaaatgcacatggcaatctatagccccagctgttacaatcaagccctctccagcaat |
38727028 |
T |
|
| Q |
101 |
aacttcagtattagcctagatatgggacggtgcaatataagctgtatcaagataatggaggaattcaacccattgccgcagatatctggaaaggaactta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38727027 |
aacttcagtattagcctagatatgggacggtgcaatataagctgtatcaagataatgaaggaattcaacccattgccgcagatatctggaaaggaactta |
38726928 |
T |
|
| Q |
201 |
ccccaaagattatattaacaccgtgcataacatctggatttcctgcttttccaattgaggcaataag |
267 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38726927 |
ccccaaagatcatattaacaccgtgcataacatctggatttcctgcttttccaattgaggcaataag |
38726861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University