View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14638_low_28 (Length: 250)
Name: NF14638_low_28
Description: NF14638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14638_low_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 130 - 250
Target Start/End: Original strand, 34128086 - 34128206
Alignment:
| Q |
130 |
aggagtccctagtgtcttgtcaatacataacatcaagaactaatgagatggagatttgtatactttagagacatcttattatttttatatactttagaga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
34128086 |
aggagtccctagtgtcttgtcaatacataacgtcaagaactaatgagatggagatttgtatactttagggacagcttattatttttatatactttagaga |
34128185 |
T |
 |
| Q |
230 |
ctaagtcggagacaaagtgtt |
250 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34128186 |
ctaagtcggagacaaagtgtt |
34128206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 233
Target Start/End: Complemental strand, 36747817 - 36747773
Alignment:
| Q |
189 |
atactttagagacatcttattatttttatatactttagagactaa |
233 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
36747817 |
atactttagagacaacttattatacttatatactttagagactaa |
36747773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 233
Target Start/End: Complemental strand, 39078020 - 39077974
Alignment:
| Q |
187 |
gtatactttagagacatcttattatttttatatactttagagactaa |
233 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
39078020 |
gtatactttagagacaacttattatacttatataatttagagactaa |
39077974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University