View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14638_low_29 (Length: 249)
Name: NF14638_low_29
Description: NF14638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14638_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 22421954 - 22421733
Alignment:
| Q |
18 |
agaaaatggcgtcggagattttcaacatgccggtggaggattgggataaatggggggataattttgagaaaccgtttggtgaagggagtttgtcgggttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
22421954 |
agaaaatggcgtcggagattttcaacatgccggtgaaggattgggatgaatggggagataatttcgagaaaccgtttggtgaagggagttcttcgggttc |
22421855 |
T |
 |
| Q |
118 |
gacgagtcggaacgatgatagtccggttgttagggtttattttaagggtttagtgagtgaggaggttgtgagaggtgagaatgtttctttggctgggatt |
217 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
22421854 |
gacgatgcggaacaatgaaggtccggttgttagggtttattttaagggtttagtgagtgaggagagtgtgagaggtgagagtgtttctttggctgggatt |
22421755 |
T |
 |
| Q |
218 |
ggtgttgctgtttgtgatgatg |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
22421754 |
ggtgttgctgtttgtgatgatg |
22421733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University