View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14638_low_34 (Length: 227)
Name: NF14638_low_34
Description: NF14638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14638_low_34 |
 |  |
|
| [»] scaffold0351 (1 HSPs) |
 |  |  |
|
| [»] scaffold0263 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 7 - 102
Target Start/End: Complemental strand, 30958247 - 30958152
Alignment:
| Q |
7 |
aagcgatcaatgaactagcccttaagacgaatttatttctttgatgaaacaatttttcgttgaattttacttatatctaaccaattctaaattacg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30958247 |
aagcgatcaatgaactagcccttaagacgaatttatttctttgatgaaacaatttttcgttgaattttacttatatctaaccaattctaaattacg |
30958152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 167 - 227
Target Start/End: Complemental strand, 30958105 - 30958045
Alignment:
| Q |
167 |
cttacattgttgttaggtttgttgttattgcttgcaattgttttgggcattggttaccgct |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30958105 |
cttacattgttgttaggtttgttgttattgcttgcaattgttttgggcattggttaccgct |
30958045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 221
Target Start/End: Original strand, 28462066 - 28462100
Alignment:
| Q |
187 |
gttgttattgcttgcaattgttttgggcattggtt |
221 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28462066 |
gttgttattgcttgcaattgttttgggtattggtt |
28462100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0351 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0351
Description:
Target: scaffold0351; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 212
Target Start/End: Original strand, 2024 - 2068
Alignment:
| Q |
168 |
ttacattgttgttaggtttgttgttattgcttgcaattgttttgg |
212 |
Q |
| |
|
||||||||||||||| | ||||||||| |||||| |||||||||| |
|
|
| T |
2024 |
ttacattgttgttagatatgttgttatcgcttgctattgttttgg |
2068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0263 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0263
Description:
Target: scaffold0263; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 212
Target Start/End: Complemental strand, 5036 - 4992
Alignment:
| Q |
168 |
ttacattgttgttaggtttgttgttattgcttgcaattgttttgg |
212 |
Q |
| |
|
||||||||||||||| | ||||||||| |||||| |||||||||| |
|
|
| T |
5036 |
ttacattgttgttagatatgttgttatcgcttgctattgttttgg |
4992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University