View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14639_high_3 (Length: 433)
Name: NF14639_high_3
Description: NF14639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14639_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 79 - 421
Target Start/End: Complemental strand, 42702685 - 42702343
Alignment:
| Q |
79 |
gaaatactaatcctgaaatttggaacatccaatctcgatcctacagccacagacgagctgattatgtgcatgcgtcgaattattaactgcagcaaatcca |
178 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| || ||||| ||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
42702685 |
gaaatactaattttgaaatttggatcatccaatctcgatccaacggccaccgacgagctgattatgtgaatgcgtagaattattaactgcagcaaatcca |
42702586 |
T |
 |
| Q |
179 |
aattcctcaaacattcaggagttacataattttcagttctcatttccaagcacaagaagcaaccaaatctctattcatccaaccaagatatagagctcca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42702585 |
aattcctcaaacattcaggagttacataattttcagttctcatttccaagcacaagaagcaaccaaatctctattcatccaaccaagatatagagctcca |
42702486 |
T |
 |
| Q |
279 |
tctctttcttgaagtctatatctatcactgtagttttcaagcaatttctttattgtaccattcaccaaagaactcagagggtaaggagtgaaaccagcca |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42702485 |
tctctttcttgaagtctatatctatcactgtagttttcaagcaatttctttattgtaccattcaccaaagaactcagagggtaaggagtgaaaccagcca |
42702386 |
T |
 |
| Q |
379 |
ttgcaaatcttgacctccacttccctagcagctcgtgtcgttc |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42702385 |
ttgcaaatcttgacctccacttccctagcagctcgtgtcgttc |
42702343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University