View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14639_low_11 (Length: 270)
Name: NF14639_low_11
Description: NF14639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14639_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 44706256 - 44706004
Alignment:
| Q |
1 |
tacagtgaaaggaaagatgtagttgatgaattgtcacatatacactctgagaaaccttcagttggaagtacttctccaaaagagcctgttaaatcaagtg |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
44706256 |
tacagtgaaaggaaggatgtagttgatgaattgtcacatatacactctgagaaaccttcagttggaaatacttctccaaaagatcctgttaaatcaagtg |
44706157 |
T |
 |
| Q |
101 |
atgatagtaggtttgggattatatgagacttgagttcattctcaaatctcaatccttaacattatgagtacagttgcattgatttagttttgcttagtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44706156 |
atgatagtaggtttgggattatatgagacttgagttcattctcaaatctcaatccttaacattatgagtacagttgcattgatttagttttgcttagtta |
44706057 |
T |
 |
| Q |
201 |
tatagtcagtcttcattcaaatctcaattttttgtgtgaggacgattcttgtt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44706056 |
tatagtcagtcttcattcaaatctcaattttttgtgtgaggacgattcttgtt |
44706004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University