View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14639_low_17 (Length: 235)
Name: NF14639_low_17
Description: NF14639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14639_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 9 - 219
Target Start/End: Original strand, 26600686 - 26600895
Alignment:
| Q |
9 |
actgtgcatgcaggtttttggtttctgtgtactgatcatatggtataagaagcaaattcttttcctttgtttattagcttgtgtatatgtttctaattac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26600686 |
actgtgcatgcaggtttttggtttctgtgtactgatcatatggtataagaagcaaattcttttcctttgtttattagcttgtg--tatgtttctaattac |
26600783 |
T |
 |
| Q |
109 |
atcgaatttgacgaaatcacattgacactgaatttgttaatgctttaaagtgta-atttttatcaaaactacgacggcgtgcagtgatttcacaaagttt |
207 |
Q |
| |
|
| ||| ||||||||||||||||||||||| ||||| ||||||||||||| |||| |||||| |||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
26600784 |
accgagtttgacgaaatcacattgacactaaatttattaatgctttaaaatgtatatttttgtcaaaactacgatgacgtacagtgatttcacaaagttt |
26600883 |
T |
 |
| Q |
208 |
attccaaacata |
219 |
Q |
| |
|
|||||||||||| |
|
|
| T |
26600884 |
attccaaacata |
26600895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University