View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1463_low_10 (Length: 218)
Name: NF1463_low_10
Description: NF1463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1463_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 16 - 124
Target Start/End: Complemental strand, 16381199 - 16381091
Alignment:
| Q |
16 |
gattataactatgaaaacaaagggtgggtagaaaacatttgaaccatgaaatgcaaaggaatatgtgatagtgctttgactttgtatcttgtaattttgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16381199 |
gattataactatgaaaacaaagggtgggtagaaaacatttgaaccatgaaatgtagaggaatatgtgatagtgctttgactttgtatcttgtaattttgt |
16381100 |
T |
|
| Q |
116 |
aatcttaag |
124 |
Q |
| |
|
||||||||| |
|
|
| T |
16381099 |
aatcttaag |
16381091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University