View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14640_high_23 (Length: 261)
Name: NF14640_high_23
Description: NF14640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14640_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 118 - 253
Target Start/End: Original strand, 10246309 - 10246444
Alignment:
| Q |
118 |
acgtacacaagtttgtagtatgggacaagagacagagaaactaaaagatgttgaaagtttaagtcagttgctgaggtcaagattcacctcaatatgcaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10246309 |
acgtacacaagtttgtagtatgggacaagagacagagaaacttaaagatgttgaaagtttaagtcagttgctgaggtcaagattcacctcaatatgcaat |
10246408 |
T |
|
| Q |
218 |
agtatatataggcacattaaattaaggttcatctca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10246409 |
agtatatataggcacattaaattaaggttcatctca |
10246444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 10246190 - 10246242
Alignment:
| Q |
7 |
gttttgcccttcagtaactctgatgcagtttcttttttaagaaagaaaaacaa |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10246190 |
gttttgcccttcagtaactctgatgcagtttcttttttaagaaagaaaaacaa |
10246242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University