View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14640_high_24 (Length: 254)
Name: NF14640_high_24
Description: NF14640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14640_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 187
Target Start/End: Original strand, 37916323 - 37916494
Alignment:
| Q |
16 |
ataatactataaataatggcttcataattattcagtcaaatttgattgagtgcctattgggaaatcttcatggaatctttttctttcttagtaggtggct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37916323 |
ataatactataaataatggcttcataattattcagtcaaatttgattgagtggctattgggaaatcttcatggaatctttttctttcttagtaggtggct |
37916422 |
T |
 |
| Q |
116 |
tgtgatgtttgtagtggtgttgggcggaggtagtgatcggggctggcccatatacccataatatgtggaatc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37916423 |
tgtgatgtttgtagtggtgttgggcggaggtagtgatcggggctggcccatatacccataatatgtggaatc |
37916494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University