View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14640_high_7 (Length: 392)
Name: NF14640_high_7
Description: NF14640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14640_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 9883938 - 9884021
Alignment:
| Q |
1 |
aataaaattagatgaataaatctatatcttctata-taatataggaaagaaagatgttgcggaaaatacaacactacccttatt |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9883938 |
aataaaattagatgaataaatctatatcttctatagtaatataggaaagaaagatgttgtggaaaatacaacactacccttatt |
9884021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University