View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14640_low_12 (Length: 309)
Name: NF14640_low_12
Description: NF14640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14640_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 4 - 293
Target Start/End: Original strand, 35351453 - 35351742
Alignment:
| Q |
4 |
agcataggaaacaaccaaaccatgaaatgagcgaggaccaggactcaaaccagcagcaatcatatcatacataacttgagaaactccggttgagtcacgg |
103 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351453 |
agcataggaaacaaccaaaccatgaaacgagcgaggaccaggactcaaaccagcagcaatcatatcatacataacttgagaaactccggttgagtcacgg |
35351552 |
T |
|
| Q |
104 |
ttcctagaccggttcatgagctcttccatgaaactgaaccggagactgttctcaagtaaagtgtcatcatctttcacttgcttcttctttctggttcgct |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351553 |
ttcctagcccggttcatgagctcttccatgaaactgaaccggagactgttctcaagtaaagtgtcatcatctttcacttgcttcttctttctggttcgct |
35351652 |
T |
|
| Q |
204 |
tctctggagaagatagcgctgctcgaactggtccggttcgaggagttaagcggtttaatttgaaggggatgtaagtggagccgtaactgt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351653 |
tctctggagaagatagcgctgctcgaactggtccggttcgaggagttaagcggtttaatttgaaggggatgtaagtggagccgtaactgt |
35351742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University