View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14641_high_10 (Length: 226)
Name: NF14641_high_10
Description: NF14641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14641_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 207
Target Start/End: Original strand, 42004125 - 42004315
Alignment:
| Q |
17 |
cacagatagtaaaaattttgtgtgacaaaactaaaatgaatttaacgtaatggaagatcattgagagcataggaaagtacctgttgacttaatcgaatgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42004125 |
cacagatagtaaaaattttgtgtgacaaaactaaaatgagtttaacataatggaagatcattgagagcataggaaagtacctgttgacttaatcgaatgt |
42004224 |
T |
|
| Q |
117 |
cggaagattctgagtcaagctgtacattgccagtgtggtcaagattttggcactcttccttgtctttcttcaactgctctggtcctagatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42004225 |
cggaagattctgagtcaagctgtacattgccagtgtggtcaagattttggcactcttccttgtctttcttcaactgctctggtcctagatg |
42004315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 144
Target Start/End: Original strand, 42012922 - 42013016
Alignment:
| Q |
48 |
taaaatgaatttaacgtaatggaagatcattgagagcataggaaagtacctgttgacttaatcgaatgtcggaagattctgagtcaagctgtacatt |
144 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||| ||||||| |||| |||||||||||||||| ||||||| || ||||||||||| |||||| |
|
|
| T |
42012922 |
taaaatgaatttaatgtattggaaggtcattgagaaaataggaa--taccagttgacttaatcgaatatcggaaggttgtgagtcaagctctacatt |
42013016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University