View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14641_high_5 (Length: 329)
Name: NF14641_high_5
Description: NF14641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14641_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 11 - 222
Target Start/End: Complemental strand, 4062531 - 4062320
Alignment:
| Q |
11 |
aagaatatgatagaagatgacatctataagaccggaaggttagcactaaaatatgcaaagaaaattattaatacaaactctagagcataatatagtatat |
110 |
Q |
| |
|
|||| ||||||||||||||| || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4062531 |
aagagtatgatagaagatgaaatttataaaaccggaaggttagcacttaaatatgcaaagaaaattattaatacacactctagagcataatatagtatat |
4062432 |
T |
|
| Q |
111 |
atcgttgtcatagtcttaacccaacaatttatatattgcaaatttttctttctgtttcaatcaaatttacactatcgtttgttatgccatcatctaaacc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4062431 |
atcgttgtcatagtcttaacccaacaatttatatattgcaaatttttctttctgtttcaatcaaatacacactatcgtttgttatgccatcatctaaacc |
4062332 |
T |
|
| Q |
211 |
actcatccatgc |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
4062331 |
gctcatccatgc |
4062320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 248 - 312
Target Start/End: Complemental strand, 47206559 - 47206495
Alignment:
| Q |
248 |
tttttatttatttacttcttttgaactctcagcaattggatgaaacacttaagggatggctgaat |
312 |
Q |
| |
|
||||||| |||||| ||||| |||||||||||| |||||||||| ||| ||| ||||||||||| |
|
|
| T |
47206559 |
tttttatgtatttatttcttatgaactctcagccattggatgaagcacgtaattgatggctgaat |
47206495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 293
Target Start/End: Original strand, 38586175 - 38586235
Alignment:
| Q |
233 |
tttcaaaactgttggtttttatttatttacttcttttgaactctcagcaattggatgaaac |
293 |
Q |
| |
|
|||||||||||||| |||||||||||||| || || |||| ||||| | ||||||||||| |
|
|
| T |
38586175 |
tttcaaaactgttgttttttatttatttatttgttatgaattctcaacggttggatgaaac |
38586235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University