View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14641_low_11 (Length: 239)
Name: NF14641_low_11
Description: NF14641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14641_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 27 - 221
Target Start/End: Complemental strand, 18224026 - 18223832
Alignment:
| Q |
27 |
aattgttacgacaacacaattattatacatttttgtcatatactctaactannnnnnnaatgtatttactttatcgtcttattctttcatttcattgtca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18224026 |
aattgttacgacaacacaattattatacatttttgtcatatactctaactatttttttaatgtatttactttatcgtcttattctttcatttcattgtca |
18223927 |
T |
|
| Q |
127 |
aaaaagggaaaacaccaaaagttagacatcacccttaccctttgtgattggtatagcattaaaaagacaaagcatggatgttaccttgggttcat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18223926 |
aaaaagggaaaacaccaaaagttagacatcacccttaccctttgtgattggtatagcattgaaaagacaaagcatggatgttaccttgggttcat |
18223832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University