View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_high_31 (Length: 303)
Name: NF14642_high_31
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 13 - 287
Target Start/End: Complemental strand, 29035299 - 29035023
Alignment:
| Q |
13 |
attattcttggagtttagaccccgtattgtagtgaagtcctccaaatttattggacgatatctttattttttagatggatcagacgatatcatttgatgg |
112 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29035299 |
attattcttgaagtttagaccccgtgttgttgtgaagtcctccaaatttattggacgatatctttgttttttagatggatcagacgatatcatttgatgg |
29035200 |
T |
|
| Q |
113 |
tatattttttactcattttatctatcgaaaaatatctttgaaaatgtattttgcctgttttgagcaacacataaggcctaaagagcaaccatcaacat-c |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29035199 |
tatattttttactcattttatctatcgaaaaatatctttgaaaatgtattttgcctgttttgagcaacacataaggcctaaagagcaaccatcaacatcc |
29035100 |
T |
|
| Q |
212 |
attgatgtgc-aaacacagattgtttgcacaaaataaatnnnnnnngatggacaggttcattgctattgcatgaaac |
287 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29035099 |
attgatgtgcaaaacacagattgtttgcacaaaataaataaaaaaagatggacaggttcattgctattgcatgaaac |
29035023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University