View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_high_55 (Length: 228)
Name: NF14642_high_55
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_high_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 23 - 211
Target Start/End: Original strand, 32971423 - 32971609
Alignment:
| Q |
23 |
cccgattctatgcaatctcatgtgattgatgatcatgtatttagtgcaaacatgct-aaaaaagagattggagggatcaatattgtaggttgtaatgaca |
121 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32971423 |
cccgattccatgcaatctcatgtgattgaagatcatgtatttagtgcaaacatgctaaaaaaagagattggagggatcaatattgtaggtggtaatgaca |
32971522 |
T |
 |
| Q |
122 |
aaattaaccccnnnnnnnttaaatgtggagaatcctattcccatgtctgcatatttgtaaaagaagtaatgcaatttattatggtcatag |
211 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32971523 |
aaattaacccc---aaaattaaatatggagaatcctattcccatgtctacatatttgtaaaagaagtaatgcaatttattatggtcatag |
32971609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University