View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_high_63 (Length: 213)
Name: NF14642_high_63
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_high_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 2654552 - 2654719
Alignment:
| Q |
19 |
atcggtagaattgcgtcaagaaatttcgagtaaaagtaaggattataattttcatgttaagaaccgatgaatgcatagttagaccatgtaaacaaatgta |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2654552 |
atcgatagaattgcgtcaagaaatttcgagtaaaagtaaggattataattttcatcttaagaaccgatgaatgcatagttagaccatgtaaacaaatgta |
2654651 |
T |
|
| Q |
119 |
aacgtttcaaccaagtaattatgcaataatttattcatgtactgtgttcatcaagtggttattttcaa |
186 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2654652 |
aacgtttccaccaagtaattatgcaataatttatttatgtactgtgttcatcaagtggttattttcaa |
2654719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University