View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_low_25 (Length: 355)
Name: NF14642_low_25
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 22 - 350
Target Start/End: Original strand, 10750722 - 10751052
Alignment:
| Q |
22 |
atgccaaataagtgggagagaaagtggtttgtttatttgtg--ttttcaattgtgaatgagggaggctttggatggattaggttttaaacaaaataaaga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10750722 |
atgccaaataagtgggagagaaagtggtttgtttatttgtgtgttttcaattgtgaatgagggaggctttggatggattaggttttaaacaaaataaaga |
10750821 |
T |
 |
| Q |
120 |
tagggaattaaggtttacatcatgaaggatgggcctagttgaggcattttacacatttgtttaataaaatatattttgttttttatacaaacactttggg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
10750822 |
tagggaattaaggtttacatcatgaaggatgggcctagttgaggcattttacacatttgtttaataaaatatattttgttttttatacaaatagtttggg |
10750921 |
T |
 |
| Q |
220 |
tgttcattaagggacatgagtagaactaacattattgttgcttctaatttgaagtctcatcatgcattagcattatatattgttttcattgtactatact |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10750922 |
tgttcattaagggacatgagtagaactaacattattgttgcttctaatttgaagtctcatcatgcattagcattatatattgttttcattgtactatact |
10751021 |
T |
 |
| Q |
320 |
ctctttgattctcaatgcatttcttttctct |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10751022 |
ctctttgattctcaatgcatttcttttctct |
10751052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University