View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_low_31 (Length: 308)
Name: NF14642_low_31
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 16 - 290
Target Start/End: Original strand, 41263849 - 41264123
Alignment:
| Q |
16 |
atcaatgaacagtattagcatcacaattacagatgaaagtgtcgaaaatatgcatatggaagatcactttgagtgaagatattttgattaccgtgtaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263849 |
atcaatgaacagtattagcatcacaattatagatgaaagtgtcgaaaatatgcatatggaagatcactttgagtgaagatattttgattaccgtgtaata |
41263948 |
T |
 |
| Q |
116 |
acccctttcgatcgaggcaacagaatttcagtagataaacaggagaagatgtggtgggtttctggacgtgataaaacgaggctacacaggggggacaaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41263949 |
acccctttcgatcgaggcaacagaatttcagtagataaacaggagaagatgtggtgggtttctggacgagataaaacgaggctacacaggggggacaaat |
41264048 |
T |
 |
| Q |
216 |
tgcctgaagacggtctttcagataagaataactcatcctaggaagcaatatagattgtggaataacccacaatac |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41264049 |
tgcctgaagacggtctttcagataagaataactcatcctaggaagcaatatagattgtggaataacccacaatac |
41264123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University