View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_low_51 (Length: 249)
Name: NF14642_low_51
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_low_51 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 7 - 249
Target Start/End: Original strand, 36574595 - 36574837
Alignment:
| Q |
7 |
agagatgaaaactaggaaaaattgtgttttagaagaggaacatacttggatggctgcttgaagcaatttggaggaatatgatggatctgtatctctgaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574595 |
agagatgaaaactaggaaaaattgtgttttagaagaggaacatacttggatggctgcttgaagcaatttggaggaatatgatggatctgtatctctgaat |
36574694 |
T |
|
| Q |
107 |
actaatgaagacgctgccaatgcagcagccgtctcagccgcgacatcagaacctggattttgagccgagaccttatacacattgcgtggagtgtccatgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574695 |
actaatgaagacgctgccaatgcagcagccgtctcagccgcgacatcagaacctggattttgagccgagaccttatacacattgcgtggagtgtccatgt |
36574794 |
T |
|
| Q |
207 |
cctccggcctttcccaacacctgtgatccatgttcggctctcc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574795 |
cctccggcctttcccaacacctgtgatccatgttcggctctcc |
36574837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University