View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_low_56 (Length: 241)
Name: NF14642_low_56
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 19608156 - 19607933
Alignment:
| Q |
1 |
ctgattttatttttggaagaagacaccacacctacatcaccatgaacctgatcttgaatccattctaaactccacggtcttgaattaatcgatcaagttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19608156 |
ctgattttatttttggaagaagacaccacacctacatcaccatgaacctgatcttgaatccattctaaactccacggtcttgaattaatcgatcgagttg |
19608057 |
T |
 |
| Q |
101 |
ccttcgatggacaagaactttcatgttttcgtctaacattggcagcccctcggcttgttgttcacccacaccaacgcaagctgacttgttcacttcagaa |
200 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
19608056 |
ccttcggcggacaagaactttcacgttttcgtctaacattggctgcacctcggcttgttgttcacccacaccaacgcaagctgacatgttcacttcagga |
19607957 |
T |
 |
| Q |
201 |
gcaacatgaatagaaatagcttca |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
19607956 |
gcaacatgaatagaaatagcttca |
19607933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University