View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14642_low_60 (Length: 234)
Name: NF14642_low_60
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14642_low_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 15308501 - 15308570
Alignment:
| Q |
108 |
ccacagtcatatttcatctccccagcttatgaacttgaattcaagtagtggcaagttactgataaactcg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15308501 |
ccacagtcatatttcatctccccagcttatgaacttgaattcaagtagtggcaagtaactgataaactcg |
15308570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 15308614 - 15308653
Alignment:
| Q |
175 |
tcgtttagaacagatgataatagcaacaatggctttattc |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15308614 |
tcgtttggaacagatgataatagcaacaatggctttattc |
15308653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University